Open Access

High quality draft genome of Lactobacillus kunkeei EFB6, isolated from a German European foulbrood outbreak of honeybees

  • Marvin Djukic43,
  • Anja Poehlein43,
  • Juliane Strauß43,
  • Fabian Jannik Tann43,
  • Andreas Leimbach43,
  • Michael Hoppert44 and
  • Rolf Daniel43Email author
Standards in Genomic Sciences201510:16

https://doi.org/10.1186/1944-3277-10-16

Received: 20 May 2014

Accepted: 4 December 2014

Published: 19 February 2015

Abstract

The lactic acid bacterium Lactobacillus kunkeei has been described as an inhabitant of fructose-rich niches. Here we report on the genome sequence of L. kunkeei EFB6, which has been isolated from a honeybee larva infected with European foulbrood. The draft genome comprises 1,566,851 bp and 1,417 predicted protein-encoding genes.

Keywords

Lactobacillus kunkeei Lactic acid bacteria European foulbrood Honeybee Cellular surface protein Biofilm formation

Introduction

Honeybees are the most economically valuable pollinators of agricultural crops [1]. A disappearance of honeybees would result in an approximately 90% decrease in production of some fruits [2]. European foulbrood (EFB) and American foulbrood (AFB) are the two most important honeybee diseases affecting the brood [3]. While the AFB is caused by the spore-forming, Gram positive bacterium Paenibacillus larvae[4], EFB is caused by the capsule-producing Melissococcus plutonius[5]. It has been shown that members of the lactic acid bacteria (LABs) inhibit the growth of M. plutonius[6] and P. larvae[7]. LABs are found in a variety of habitats, including human and animal microbiomes, and are used as food additives.

The honeybee crop microbiome consists of 13 bacterial species belonging to the genera Lactobacillus and Bifidobacterium[8]. These bacteria play a key role in the production of honey and bee bread. The latter serves as long-term food storage for adult honeybees and larvae. L. kunkeei is a common symbiont for Apis and the dominating LAB member in bees [6]. The organism is a specialist for colonization of the honeybee crop and interacts with the epithelial layer of the crop. L. kunkeei has been described as a fructophilic LAB [9]. Initially, it was isolated from wine [10], but it has also been found on flowers and in honey.

L. kunkeei EFB6 is the first LAB isolated from a German EFB-diseased larva. Here, we describe genomic features of this organism, focusing on factors that improve competition with bacteria such as M. plutonius and P. larvae. In addition, potential cell surface proteins that might play a role in cellular adhesion and biofilm formation are analyzed.

Organism information

In October 2012, an EFB outbreak in Bavaria (Germany) was confirmed. EFB-diseased larvae from this outbreak were collected, immediately frozen in liquid nitrogen and stored at -80°C for further investigation. Several EFB-infected larvae were dissected under sterile conditions. To obtain LAB the guts of the larvae, which formed a yellow, glue-like slime, were suspended in MRS medium (Carl Roth GmbH & Co KG, Karlsruhe, Germany) and subsequently streaked on solidified MRS to isolate single colonies. Strain L. kunkeei EFB6 (Table 1, Additional file 1: Table S1) was isolated from these agar plates after aerobic incubation at 35°C.
Table 1

Classification and general features of Lactobacillus kunkeei EFB6

MIGS ID

Property

Term

Evidence code

 

Classification

Domain Bacteria

TAS [11]

  

Phylum Firmicutes

TAS [1215]

  

Class Bacilli

TAS [16]

  

Order Lactobacillales

TAS [17]

  

Family Lactobacillaceae

TAS [18]

  

Genus Lactobacillus

TAS [1821]

  

Species Lactobacillus kunkeei

TAS [10]

  

strain: EFB6

TAS (this study)

 

Gram stain

Positive

TAS [10]

 

Cell shape

Rod-shaped

IDA

 

Motility

Non-motile

IDA

 

Sporulation

Non-sporulating

NAS

 

Temperature range

Mesophile

TAS [10]

 

Optimum temperature

30°C

NAS

 

pH range; Optimum

4.5-6.2; 6

NAS

 

Carbon source

Varied

NAS

MIGS-6

Habitat

Honeybee larva

IDA

MIGS-6.3

Salinity

5% NaCl (w/v)

TAS [10]

MIGS-22

Oxygen requirement

Facultative

IDA

MIGS-15

Biotic relationship

Host-associated

TAS [6]

MIGS-14

Pathogenicity

Non-pathogen

NAS

 

Biosafety level

1

TAS [22]

MIGS-23

Isolation

EFB-diseased honeybee larva

IDA

MIGS-4

Geographic location

Bavaria, Germany

IDA

MIGS-5

Sample collection

October 1, 2012

IDA

MIGS-4.1

Latitude

49°14′ N

IDA

MIGS-4.2

Longitude

11°05′ E

IDA

MIGS-4.4

Altitude

400 m a.s.l

IDA

L. kunkeei EFB6 is a non-sporulating, low G + C Gram positive member of the Lactobacteriaceae and taxonomically related to the genus Pediococcus. The strain exhibited a 100% 16S rRNA gene nucleotide sequence identity to the type strain L. kunkeei YH-15 (Table 1, Figure 1). Cells harvested in exponential growth phase exhibited a length ranging from 0.7 to 1.3 μm and a diameter ranging from 0.3 to 0.5 μm as determined by transmission electron microscopy (TEM) of either negatively stained or ultrathin-sectioned samples (Figure 2). Preparations for ultrathin sectioning and negative staining of cells were performed as described by [23]. The L. kunkeei EFB6 cell wall is approximately 12 nm thick. This value is rather thin compared to cell walls of other Gram positives [24]. Three distinct wall layers of L. kunkeei EFB6 (two darker stained outer and inner layers and a brighter layer in between) could be distinguished by TEM. Surface layers and cellular appendages (pili, fimbriae) were not detected.
Figure 1

Phylogenetic tree highlighting the position of L. kunkeei EFB6 relative to other Lactobacillus strains based on 16S rRNA gene sequences. GenBank accession numbers are indicated in parentheses. Asterisks indicate that a consensus sequence was calculated from all 16S rRNA gene sequences present in the corresponding genome. L. kunkeei EFB6 is boxed. Sequences were aligned using ClustalW 1.6 [25]. The phylogenetic tree was obtained by using the UPGMA method within MEGA 6.06 software [26]. Numbers at nodes are bootstrap values calculated from 1,000 resamplings to generate a majority consensus tree. Bacillus subtilis DSM10 was used as outgroup. The scale bar indicates the nucleotide sequence divergence.

Figure 2

Electron microscopy of L. kunkeei EFB6. Large image and upper right inset: stained ultrathin sections; lower right inset: negatively stained single cell (staining salt: uranyl acetate, 4 %, w/v).

Genome sequencing and annotation

Genome project history

The organism was selected for sequencing on the basis of its use as potential inhibitor for the primary agents of AFB and EFB [6, 7]. The aim was to investigate potential factors to increase bacterial competition fitness and cell surface proteins, which might be important for cellular adhesion and biofilm formation.

A summary of the project information is shown in Table 2.
Table 2

Genome sequencing project information

MIGS ID

Property

Term

MIGS-31

Finishing quality

Improved high-quality draft

MIGS-28

Libraries used

One Illumina paired-end library with1 kb insert size

MIGS-29

Sequencing platforms

Illumina GAII

MIGS-31.2

Fold coverage

142.96 × Illumina

MIGS-30

Assemblers

SPAdes 2.5

MIGS-32

Gene calling method

YACOP, Glimmer

 

Locus Tag

LAKU

 

Genbank ID

AZBY00000000

 

GenBank Date of Release

May, 2014

 

GOLD ID

Gi0053745

 

NCBI project ID

227106

 

BIOPROJECT

PRJNA227106

 

Project relevance

Host-associated

Growth conditions and DNA isolation

To isolate genomic DNA L. kunkeei EFB6 was grown aerobically in 50 ml MRS medium at 35°C with shaking at 150 rpm (Lab-Therm Lab-Shaker, Adolf Kühner AG, Birsfelden, Switzerland). Cells were harvested in exponential growth phase using a Beckman Coulter Allegra™ X-12R centrifuge (Beckman Coulter GmbH, Krefeld, Germany) for 25 minutes at 2,750 g and 4°C. Genomic DNA was isolated using the Epicentre® MasterPure™ DNA Purification kit (Epicentre®, Madison, WI, USA).

Genome sequencing and assembly

Whole-genome sequencing of L. kunkeei EFB6 was performed by employing the Genome Analyzer II (Illumina, San Diego, CA). The shotgun library was prepared according to the manufacturer’s protocols. For de novo assembly, we used 2,000,000 paired-end Illumina reads (112 bp) and the SPAdes 2.5 software [27]. The final assembly contained 55 contigs larger than 500 bp and revealed an average coverage of 142.96.

Genome annotation

For automatic gene prediction the software tools YACOP [28] and Glimmer [29] were used. Identification of rRNA and tRNA genes was performed by employing RNAmmer [30] and tRNAscan [31], respectively. The annotation provided by the IMG-ER system [32] was corrected manually. For this purpose, data obtained from different databases (Swiss-Prot [33], TrEMBL [34] and InterPro [35]) were used to improve the quality of the annotation.

Genome properties

The genome statistics are provided in Table 3. The high quality draft genome sequence consists of 55 contigs that account for a total of 1,566,851 bp and a G + C content of 37 mol%. Of the 1,455 predicted genes, 1,417 were putatively protein-encoding, 35 represented putative tRNA genes and three putative rRNA genes. For the majority of the protein-encoding genes (75%) a function could be assigned. The distribution of these genes into COG functional categories [36] is shown in Table 4.
Table 3

Genome statistics

Attribute

Value

Genome size (bp)

1,566,851

DNA coding (bp)

1,413,077

DNA G + C (bp)

578,359

DNA scaffolds

55

Total genes

1,455

Protein coding genes

1,417

RNA genes

38

Pseudo Genes

0

Genes in internal clusters

20

Genes with function prediction

1,012

Genes assigned to COGs

1,195

Genes assigned Pfam domains

1,221

Genes with signal peptides

62

Genes with transmembrane helices

419

CRISPR repeats

0

Table 4

Number of genes associated with the general COG functional categories

Code

Value

% age

Description

J

137

10.57

Translation, ribosomal structure and biogenesis

A

0

0.00

RNA processing and modification

K

95

7.33

Transcription

L

94

7.25

Replication, recombination and repair

B

0

0.00

Chromatin structure and dynamics

D

24

1.85

Cell cycle control, cell division, chromosome partitioning

V

18

1.39

Defense mechanisms

T

32

2.47

Signal transduction mechanisms

M

88

6.79

Cell wall/membrane biogenesis

N

10

0.77

Cell motility

U

25

1.93

Intracellular trafficking and secretion

O

45

3.47

Posttranslational modification, protein turnover, chaperones

C

49

3.78

Energy production and conversion

G

67

5.17

Carbohydrate transport and metabolism

E

112

8.64

Amino acid transport and metabolism

F

68

5.25

Nucleotide transport and metabolism

H

34

2.62

Coenzyme transport and metabolism

I

35

2.70

Lipid transport and metabolism

P

61

4.71

Inorganic ion transport and metabolism

Q

13

1.00

Secondary metabolites biosynthesis, transport and catabolism

R

155

11.96

General function prediction only

S

134

10.34

Function unknown

-

260

17.87

Not in COGs

Table 5

Primer used in this study

Primer

DNA sequence (5′-3′)

Open reading frame

Product size

LKU_ORF1A_for

AACCAAGAGTAACGATGCCC

LAKU_4c00030

536 bp

LKU_ORF1A_rev

CTTTGGTAATCGGCTTGTGC

  

LKU_ORF1B_for

CGATGCACAAACTGCTTACG

LAKU_4c00030

355 bp

LKU_ORF1B_rev

CATCCTTTTGTGCGTCGTTG

  

LKU_ORF2_for

AGCTCTTTTAGGTGCGTCTG

LAKU_4c00040

323 bp

LKU_ORF2_rev

TATGCGTCTTGGTGGTTTGC

  

LKU_ORF3_for

GCGACTTTGTCTGTTTTGGG

LAKU_4c00050

358 bp

LKU_ORF3_rev

ATAGCCCCAGCATATCCAGC

  

LKU_ORF4_for

CTACGTTGAGGTTTCCGCTC

LAKU_4c00060

566 bp

LKU_ORF4_rev

GTTGGAGTTACCTTGCCACC

  

LKU_ORF5_for

TCCCAGTAGTAACAAGTAACACC

LAKU_4c00070

358 bp

LKU_ORF5_rev

AAGCGGTTGATTTCCATTGAC

  

Insights into the genome

Five different Lactobacillus species were used for genome comparisons with L. kunkeei EFB6 based on blastp [37]. Results are shown in Figure 3. All five species are of interest as probiotics, part of the gastrointestinal tract of animals or humans, or used in the production of fermented food.
Figure 3

L. kunkeei EFB6 artificial circular chromosome map. Comparisons (blastp) of L. kunkeei EFB6 chromosome to Lactobacillus acidophilus 30SC (NC_015213), Lactobacillus plantarum 16 (NC_021514), Lactobacillus brevis ATCC 367 (NC_008497), Lactobacillus johnsonii NCC 533 (NC_005362), and Lactobacillus rhamnosus ATCC 8530 (NC_017491), using the BRIG software [38] are shown in black, purple, red brown, cyan, blue and green, respectively. Gene regions used for detailed analyses are depicted in an outer circle and marked in red.

The identification of orthologous proteins was performed with the program Proteinortho 5.04 [39] by using the protein content deduced from 232 lactobacilli genomes as references (GenBank database as of 28.02.2014). For this purpose ncbi_ftp_download v0.2, cat_seq v0.1 and cds_extractor v0.6 were used [40]. With an identity cutoff of 50%, we identified 425 proteins in L. kunkeei EFB6 without orthologs in any other Lactobacillus species. Among these unique L. kunkeei EFB6 proteins, we selected 7 proteins for detailed analyses.

Analysis of the 89-kb region shown in Figure 3 revealed five ORFs (LAKU_4c00030-LAKU_4c00070) without orthologs in any genomes derived from lactobacilli deposited in GenBank (as of 28.02.2014). Furthermore, no homologs could be identified in any other sequenced microbial genome (NCBI nr-database as of 05.03.2014) by using blastp (e-value cutoff of 1e-20). Except for LAKU_4c00060 (7,521 amino acids), we could identify an N-terminal signal peptide and a non-cytoplasmic domain (Figure 4A) using Phobius’ domain prediction software [41]: LAKU_4c00040 (4,579 amino acids) and LAKU_4c00070 (3,129 amino acids) contain coiled coil structures. Except of LAKU_4c00050 (8,342 amino acids), all ORFs show weak similarity to large surface proteins or extracellular matrix-binding proteins found in bacteria such as Staphylococcus, Streptococcus, Burkholderia, Weissella, Mannheimia, and Marinomonas, but also in Lactobacillus and Pediococcus. Since, L. kunkeei EFB6 is the first sequenced genome harboring these cluster, we designed specific primer pairs for detection of each ORF in other Lactobacillus strains by PCR (Table 6). As shown in Figure 4B, all five ORFs were present in other L. kunkeei strains isolated from honey and wine. On the basis of domain prediction and IMG’s bidirectional best hits [32], we assume that this gene cluster encodes cell surface or secreted proteins involved in cell adhesion or biofilm formation.
Figure 4

Domain prediction (A) of the 89-kb region found in L. kunkeei EFB6 and its presence in other lactobacilli (B). A combined transmembrane topology and signal peptide predictor [41] was used to determine putative domains. The yellow blocks represent signal peptides, the white color of the arrows show the non-cytoplasmic part. Red blocks represent transmembrane regions and blue blocks predicted coiled-coil structures. To test whether this region exists in other L. kunkeei strains, we designed specific primer-pairs for each ORF (Table 5, Figure 4A). Predicted PCR product sizes are depicted in white boxes. The presence of the genes were tested for L. kunkeei EFB6, L. kunkeei HI3 (isolated from honey), L. kunkeei DSM 12361 (isolated from wine), and L. johnsonii DSM 10533 (isolated from human blood) (Figure 4B). The obtained PCR product sizes correlated with the predicted sizes (Table 5, Figure 4A). For L. johnsonii DSM 10533, no PCR product could be obtained.

During genome comparison, we identified two additional proteins (LAKU_24c00010 and LAKU_24c00050) without a homolog in any of the publicly available genome sequences. These proteins show only weak sequence similarity to known proteins and might be involved in cellular adhesion. LAKU_24c00010 contains a signal peptide, transmembrane helices and 29 DUF1542 domains, which are typically found in cell surface proteins. In Staphylococcus aureus, it has been shown that some DUF1542-containing proteins are involved in cellular adhesion and antibiotic resistance [42]. LAKU_24c00010 showed the highest sequence identities to the matrix-binding protein (WP_010490864) of “Lactobacillus zeae” KCTC 3804 (40%) [43] and the extracellular matrix binding protein (YP_005866289) of Lactobacillus rhamnosus ATCC 53103 (36%) (Figure 5).
Figure 5

Tblastx comparison of L. kunkeei ORF LAKU_24c00010 to matrix binding proteins of L. rhamnosus ATCC 53103 and “ L. zeae ” KCTC 3804. The graphical presentation was done with Easyfig software (minimum blast hit length of 200 bp and a maximum e-value of 1e-100) [44]. LAKU_24c00010 shows similarities to WP_010490869, WP_010490864 and WP_010490862 of “L. zeae” KCTC 3804, but also to YP_005866289 (L. rhamnosus ATCC 53103). The ORFs used for comparison are labeled with NCBI accession numbers. The blast identity is shown in a colored scale ranging from 31 % (yellow) to 100 % (red).

Additionally, LAKU_24c00050 contains N terminal transmembrane helices, two mucin-binding protein domains as well as a C terminal Gram positive-anchoring domain. Proteins with this domain combination are usually associated with bacterial surface proteins. LAKU_24c00050 showed similarity to the Mlp protein (WP_004239242) of Streptococcus mitis and other mucus-binding proteins (Figure 6). Due to the mucosal surface-colonizing properties of lactobacilli, they have been investigated as potential recombinant mucosal vaccines [45].
Figure 6

Tblastx comparison of MucBP domain-containing proteins. Comparison of MucBP domain-containing proteins were performed using the program Easyfig (mininum blast hit length of 50 bp and maximum e-value of 1e-10) [44]. LAKU_24c00050 shows similarity to ORFs of Streptococcus mitis NCTC 12261 (NCBI accession numbers inside arrows, which represent ORFs used for comparison). Additionally, LAKU_24c00050 shows similarity to WP_003144513 of Gemella haemolysans ATCC 10379 and CCC15643 of Lactobacillus pentosus IG1 [46]. The blast identity is shown in a colored scale ranging from 20% (yellow) to 100% (red).

In the genome of L. kunkeei EFB6, we identified genes encoding all proteins of the general secretory (Sec) pathway and putative polysaccharide biosynthesis proteins, which may participate in capsule or S layer formation. Recently, Butler et al. (2013) [47] detected a lysozyme produced by L. kunkeei Fhon2N and suggested a bacteriolysin or class III bacteriocin function. In L. kunkeei EFB6, we identified four genes belonging to the glycoside hydrolase family 25. Enzymes of this family are known to possess lysozyme activity. Two of the deduced proteins (LAKU_13c00160 and LAKU_32c00010) contain a signal peptide, indicating secretion of the proteins. LAKU_19c00290 harbors transmembrane helices and is probably anchored in the cell wall. LAKU_6c00080 did not contain a putative signal peptide or transmembrane helices.

Rapid test PCR

Specific primer pairs have been designed to test other strains by PCR for the presence of an 89 kb region, which harbors five open reading frames (ORFs). Genomic DNA of the L. kunkeei strains EFB6, HI3 and DSM 12361, and Lactobacillus johnsonii DSM 10533 was used as template for PCR amplifications employing the thermal cycler peqSTAR 2X (PEQLAB Biotechnologie GmbH, Erlangen, Germany). PCR amplification was performed with the BIO-X-ACT™ Short DNA Polymerase (Bioline, Luckenwalde, Germany) and an initial denaturation step at 98°C for 2 min, followed by 30 cycles of denaturation for 20 s at 96°C, annealing for 20 s at 60°C and elongation for 30 s at 68°C. Subsequently, a final elongation step of 10 min at 68°C was performed. PCR products were purified employing the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany).

Conclusion

In this study, we characterized the genome of L. kunkeei strain EFB6 isolated from an EFB-diseased larva. In a recent study was shown that L. kunkeei has the potential for biofilm formation and adhesion to the honey crop [6]. Our genome analysis supports these results. Using large surface proteins or extracellular matrix-binding proteins, L. kunkeei might be able to attach to eukaryotic epithelial cells. Furthermore, due to the presence of polysaccharide biosynthesis proteins and several enzymes with lysozyme activity, it is possible that L. kunkeei is actively protecting its niche against bacterial competitors. As LABs have been shown to have an inhibitory growth effect on M. plutonius, the use of LABs as probiotic additive against the EFB-causing agent is conceivable.

Abbreviations

AFB: 

American foulbrood of honeybees

EFB: 

European foulbrood of honeybees

LABs: 

Lactic acid bacteria

TEM: 

Transmission electron microscopy.

Declarations

Acknowledgements

We thank the “Bundesministerium für Bildung und Forschung” and the “Niedersächsisches Ministerium für Wissenschaft und Kultur” for support. Additionally, we acknowledge support by the German Research Foundation and the Open Access Publication Funds of the Göttingen University.

Authors’ Affiliations

(1)
Department of Genomic and Applied Microbiology & Göttingen Genomics Laboratory, Institute of Microbiology and Genetics, Georg-August University of Göttingen
(2)
Department of General Microbiology, Institute of Microbiology and Genetics, Georg-August University of Göttingen

References

  1. Klein A-M, Vaissière BE, Cane JH, Steffan-Dewenter I, Cunningham SA, Kremen C, Tscharntke T: Importance of pollinators in changing landscapes for world crops. Proc. R. Soc. B 2007, 274:303–13. 10.1098/rspb.2006.3721View ArticlePubMed CentralPubMedGoogle Scholar
  2. Southwick EE, Southwick L Jr: Estimating the economic value of honey bees ( Hymenoptera : Apidae ) as agricultural pollinators in the United States. J. Econ. Entomol. 1992, 85:621–633. 10.1093/jee/85.3.621View ArticleGoogle Scholar
  3. Forsgren E: European foulbrood in honey bees. J. Invertebr. Pathol. 2010,103(Suppl):S5–9.View ArticlePubMedGoogle Scholar
  4. Djukic M, Brzuszkiewicz E, Fünfhaus A, Voss J, Gollnow K, Poppinga L, Liesegang H, Garcia-Gonzalez E, Genersch E, Daniel R: How to Kill the Honey Bee Larva: Genomic Potential and Virulence Mechanisms of Paenibacillus larvae . PLoS One 2014, 9:e90914. 10.1371/journal.pone.0090914View ArticlePubMed CentralPubMedGoogle Scholar
  5. Bailey L, Collins MD: Reclassification of “ Streptococcus pluton ” (White) in a new genus Melissococcus , as Melissococcus pluton nom. rev.; comb. nov. J. Appl. Microbiol. 1982, 53:215–217.Google Scholar
  6. Vásquez A, Forsgren E, Fries I, Paxton RJ, Flaberg E, Szekely L, Olofsson TC: Symbionts as major modulators of insect health: lactic acid bacteria and honeybees. PLoS One 2012, 7:e33188. 10.1371/journal.pone.0033188View ArticlePubMed CentralPubMedGoogle Scholar
  7. Forsgren E, Olofsson TC, Vásquez A, Fries I: Novel lactic acid bacteria inhibiting Paenibacillus larvae in honey bee larvae. Apidologie 2009, 41:99–108.View ArticleGoogle Scholar
  8. Olofsson TC, Vásquez A: Detection and identification of a novel lactic acid bacterial flora within the honey stomach of the honeybee Apis mellifera . Curr. Microbiol. 2008, 57:356–63. 10.1007/s00284-008-9202-0View ArticlePubMedGoogle Scholar
  9. Endo A, Irisawa T, Futagawa-Endo Y, Takano K, du Toit M, Okada S, Dicks LMT: Characterization and emended description of Lactobacillus kunkeei as a fructophilic lactic acid bacterium. Int J Syst Evol Micr 2012, 62:500–4. 10.1099/ijs.0.031054-0View ArticleGoogle Scholar
  10. Edwards CG, Haag KM, Collins MD, Hutson RA, Huang YC: Lactobacillus kunkeei sp. nov.: a spoilage organism associated with grape juice fermentations. J. Appl. Microbiol. 1998, 84:698–702. 10.1046/j.1365-2672.1998.00399.xView ArticlePubMedGoogle Scholar
  11. Woese CR, Kandler O, Wheelis ML: Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci. 1990, 87:4576–4579. 10.1073/pnas.87.12.4576View ArticlePubMed CentralPubMedGoogle Scholar
  12. Gibbons NE, Murray RGE: Proposals Concerning the Higher Taxa of Bacteria. Int. J. Syst. Bacteriol. 1978, 28:1–6. 10.1099/00207713-28-1-1View ArticleGoogle Scholar
  13. Garrity G, Holt J: The Road Map to the Manual. In Bergey’s Manual of Systematic Bacteriology. Volume 1. 2nd edition. New York: Springer; 2001:119–169.View ArticleGoogle Scholar
  14. Murray R: The Higher Taxa, or, a Place for Everything…? In Bergey’s Manual of Systematic Bacteriology. Volume 1. 1st edition. Baltimore: The Williams and Wilkins Co; 1984:31–34.Google Scholar
  15. List Editor: List of new names and new combinations previously effectively, but not validly, published. List no. 132. Int J Syst Evol Microbiol 2010, 60:469–472. doi: 10.1099/ijs.0.022855–0View ArticleGoogle Scholar
  16. Ludwig W, Schleifer K, Whitman W: Class I. Bacilli class nov. In Bergey’s Manual of Systematic Bacteriology, Second Edition, Volume 3. New York: Springer; 2009:19–20.Google Scholar
  17. Schleifer K, Whitman W: Order II. Lactobacillales ord. nov. In Bergey’s Manual of Systematic Bacteriology, Second Edition, Volume 3 (The Firmicutes). New York: Springer; 2009:464.Google Scholar
  18. Skerman V, McGowan V, Sneath P: Approved Lists of Bacterial Names. Int. J. Syst. Bacteriol. 1980, 30:225–420. 10.1099/00207713-30-1-225View ArticleGoogle Scholar
  19. Haakensen M, Dobson C, Hill J, Ziola B: Reclassification of Pediococcus dextrinicus (Coster and White 1964) Back 1978 (Approved Lists 1980) as Lactobacillus dextrinicus comb. nov., and emended description of the genus Lactobacillus . Int J Syst Evol Micr 2009, 59:615–621. 10.1099/ijs.0.65779-0View ArticleGoogle Scholar
  20. Cai Y, Pang H, Kitahara M, Ohkuma M: Lactobacillus nasuensis sp. nov., a lactic acid bacterium isolated from silage, and emended description of the genus Lactobacillus . Int J Syst Evol Micr 2012, 62:1140–1144. 10.1099/ijs.0.031781-0View ArticleGoogle Scholar
  21. Bergey DH, Breed RS, Hammer BW, Huntoon FM, Murray EGD, Harrison FC: Genus X. Lactobacillus Beijerinck, 191. In Bergey’s Manual of Systematic Bacteriology. 4th edition. Edited by: Bergey DH, Breed RS, Hammer BW, Huntoon FM, Murray EGD, Harrison FC. Baltimore: The Williams and Wilkins Co; 1934:300–321.Google Scholar
  22. Bundesanstalt für Arbeitsschutz und Arbeitsmedizin. Technical rules for biological agents. TRBA 466 Available at: http://www.baua.de/de/Themen-von-A-Z/Biologische-Arbeitsstoffe/TRBA/TRBA-466.html
  23. Hoppert M: Microscopic Techniques in Biotechnology. Weinheim, FRG: Wiley-VCH Verlag GmbH & Co. KGaA; 2003. Available at: http://doi.wiley.com/10.1002/3527602615 View ArticleGoogle Scholar
  24. Mayer F: Cytology and Morphogenesis of Bacteria (Handbook of plant Anatomy IV, 2). Stuttgart: Borntraeger; 1988.Google Scholar
  25. Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22:4673–80. 10.1093/nar/22.22.4673View ArticlePubMed CentralPubMedGoogle Scholar
  26. Kumar S, Nei M, Dudley J, Tamura K: MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 2008, 9:299–306. 10.1093/bib/bbn017View ArticlePubMed CentralPubMedGoogle Scholar
  27. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, et al.: SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19:455–77. 10.1089/cmb.2012.0021View ArticlePubMed CentralPubMedGoogle Scholar
  28. Tech M, Merkl R: YACOP: Enhanced gene prediction obtained by a combination of existing methods. In Silico Biol 2003, 3:441–451.PubMedGoogle Scholar
  29. Delcher AL, Harmon D, Kasif S, White O, Salzberg SL: Improved microbial gene identification with GLIMMER. Nucleic Acids Res. 1999, 27:4636–41. 10.1093/nar/27.23.4636View ArticlePubMed CentralPubMedGoogle Scholar
  30. Lagesen K, Hallin P, Rødland EA, Staerfeldt H-H, Rognes T, Ussery DW: RNAmmer: consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res. 2007, 35:3100–8. 10.1093/nar/gkm160View ArticlePubMed CentralPubMedGoogle Scholar
  31. Lowe TM, Eddy SR: tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997, 25:955–64. 10.1093/nar/25.5.0955View ArticlePubMed CentralPubMedGoogle Scholar
  32. Markowitz VM, Mavromatis K, Ivanova NN, Chen I-MA, Chu K, Kyrpides NC: IMG ER: a system for microbial genome annotation expert review and curation. Bioinformatics 2009, 25:2271–8. 10.1093/bioinformatics/btp393View ArticlePubMedGoogle Scholar
  33. Gasteiger E, Jung E, Bairoch A: SWISS-PROT: connecting biomolecular knowledge via a protein database. Curr Issues Mol Biol 2001, 3:47–55.PubMedGoogle Scholar
  34. O’Donovan C, Martin MJ, Gattiker A, Gasteiger E, Bairoch A, Apweiler R: High-quality protein knowledge resource: SWISS-PROT and TrEMBL. Brief. Bioinform. 2002, 3:275–84. 10.1093/bib/3.3.275View ArticlePubMedGoogle Scholar
  35. Hunter S, Jones P, Mitchell A, Apweiler R, Attwood TK, Bateman A, Bernard T, Binns D, Bork P, Burge S, et al.: InterPro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. 2012, 40:D306–12. 10.1093/nar/gkr948View ArticlePubMed CentralPubMedGoogle Scholar
  36. Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, Krylov DM, Mazumder R, Mekhedov SL, Nikolskaya AN, et al.: The COG database: an updated version includes eukaryotes. BMC Bioinformatics 2003, 4:41. 10.1186/1471-2105-4-41View ArticlePubMed CentralPubMedGoogle Scholar
  37. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J. Mol. Biol. 1990, 215:403–10. 10.1016/S0022-2836(05)80360-2View ArticlePubMedGoogle Scholar
  38. Alikhan NF, Petty NK, Ben Zakour NL, Beatson SA: BLAST Ring Image Generator (BRIG): simple prokaryote genome comparisons. BMC Genomics 2011, 12:402. 10.1186/1471-2164-12-402View ArticlePubMed CentralPubMedGoogle Scholar
  39. Lechner M, Findeiss S, Steiner L, Marz M, Stadler PF, Prohaska SJ: Proteinortho: detection of (co-)orthologs in large-scale analysis. BMC Bioinformatics 2011, 12:124. 10.1186/1471-2105-12-124View ArticlePubMed CentralPubMedGoogle Scholar
  40. Leimbach A: bac-genomics-scripts. 2014.https://github.com/aleimba/bac-genomics-scripts Google Scholar
  41. Käll L, Krogh A, Sonnhammer EL: A combined transmembrane topology and signal peptide prediction method. J. Mol. Biol. 2004, 338:1027–36. 10.1016/j.jmb.2004.03.016View ArticlePubMedGoogle Scholar
  42. Clarke SR, Harris LG, Richards RG, Foster SJ: Analysis of Ebh, a 1.1-megadalton cell wall-associated fibronectin-binding protein of Staphylococcus aureus . Infect. Immun. 2002, 70:6680–7. 10.1128/IAI.70.12.6680-6687.2002View ArticlePubMed CentralPubMedGoogle Scholar
  43. Dicks LMT, Du Plessis EM, Dellaglio F, Lauer E: Reclassification of Lactobacillus casei subsp. casei ATCC 393 and Lactobacillus rhamnosus ATCC 15820 as Lactobacillus zeae nom. rev., designation of ATCC 334 as the neotype of L. casei subsp. casei , and rejection of the name Lactobacillus paracasei . Int. J. Syst. Bacteriol. 1996, 46:337–340. 10.1099/00207713-46-1-337View ArticlePubMedGoogle Scholar
  44. Sullivan MJ, Petty NK, Beatson SA: Easyfig: a genome comparison visualizer. Bioinformatics 2011, 27:1009–10. 10.1093/bioinformatics/btr039View ArticlePubMed CentralPubMedGoogle Scholar
  45. Turner MS, Hafner LM, Walsh T, Giffard PM: Peptide surface display and secretion using two LPXTG-containing surface proteins from Lactobacillus fermentum BR11. Appl. Environ. Microbiol. 2003, 69:5855–63. 10.1128/AEM.69.10.5855-5863.2003View ArticlePubMed CentralPubMedGoogle Scholar
  46. Zanoni P, Farrow JAE, Phillips BA, Collins MD: Lactobacillus pentosus , (Fred, Peterson and Anderson) sp. nov., nom. rev. Int. J. Syst. Bacteriol. 1987, 37:339–341. 10.1099/00207713-37-4-339View ArticleGoogle Scholar
  47. Butler E, Alsterfjord M, Olofsson TC, Karlsson C, Malmström J, Vásquez A: Proteins of novel lactic acid bacteria from Apis mellifera mellifera : an insight into the production of known extra-cellular proteins during microbial stress. BMC Microbiol. 2013, 13:235. 10.1186/1471-2180-13-235View ArticlePubMed CentralPubMedGoogle Scholar

Copyright

© Djukic et al.; licensee BioMed Central. 2015

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.