Skip to content

Advertisement

Standards in Genomic Sciences

What do you think about BMC? Take part in

Open Access

Complete genome sequence of Thermotoga sp. strain RQ7

Standards in Genomic Sciences201712:62

https://doi.org/10.1186/s40793-017-0271-1

Received: 4 October 2016

Accepted: 21 September 2017

Published: 11 October 2017

Abstract

Thermotoga sp. strain RQ7 is a member of the family Thermotogaceae in the order Thermotogales. It is a Gram negative, hyperthermophilic, and strictly anaerobic bacterium. It grows on diverse simple and complex carbohydrates and can use protons as the final electron acceptor. Its complete genome is composed of a chromosome of 1,851,618 bp and a plasmid of 846 bp. The chromosome contains 1906 putative genes, including 1853 protein coding genes and 53 RNA genes. The genetic features pertaining to various lateral gene transfer mechanisms are analyzed. The genome carries a complete set of putative competence genes, 8 loci of CRISPRs, and a deletion of a well-conserved Type II R-M system.

Keywords

Thermotoga T. sp. strain RQ7Natural competenceCRISPRRestriction-modification systemTneDICP007633

Background

Thermotoga species are a group of thermophilic or hyperthermophilic bacteria that can ferment a wide range of carbohydrates and produce hydrogen gas as one of the major final products [1, 2]. Their hydrogen yield from glucose can reach the theoretical maximum: 4 mol of H2 from each mole of glucose [2, 3], which makes them ideal candidates for biofuel production. Meanwhile, because their enzymes are thermostable by nature, they also hold great prospect in the biocatalyst sector. 16S rRNA gene sequence analyses place Thermotoga at a deep branch in the tree of life, and genomic studies also reveal extensive horizontal gene transfer events between Thermotogales and other groups, particularly Archaea and Firmicutes [4]. Controversy over the phylogenetic significance of Thermotoga has triggered a prolonged debate on the concepts of species and biogeography, etc. [5].

We have been interested in the genetics of Thermotoga over the years and have developed the earliest set of tools to genetically modify these bacteria [68]. Strain RQ7 plays an essential role in these studies. This strain possesses the smallest known plasmid, pRQ7 (846 bp) [9], that is absent from most Thermotoga strains and serves as the base vector for all Thermotoga-E. coli shuttle vectors developed so far. T. sp. strain RQ7 is also the first Thermotoga strain in which natural competence was discovered [7]. To gain insights into the genetic and genomic features of the strain and to facilitate the continuing effort on developing genetic tools for Thermotoga , we set out to sequence the whole genome of T. sp. strain RQ7.

Organism information

Classification and features

T. sp. strain RQ7 was isolated from marine sediments of Ribeira Quente, Azores [1]. The strain is a member of the genus Thermotoga , the family Thermotogaceae , and the order Thermotogales (Table 1). Based on 16S rRNA gene sequences, the closest relative of T. sp. strain RQ7 is T. neapolitana DSM 4359 , and these two strains cluster with T. maritima MSB8 and T. sp. strain RQ2 (Fig. 1). The results are in agreement with previous reports [10].
Table 1

Classification and general features of Thermotoga sp. strain RQ7 according to the MIGS recommendations [36]

MIGS ID

Property

Term

Evidence codea

 

Classification

Domain Bacteria

TAS [37]

  

Phylum Thermotogae

TAS [38, 39]

  

Class Thermotogae

TAS [39, 40]

  

Order Thermotogales

TAS [39, 41]

  

Family Thermotogaceae

TAS [39, 42]

  

Genus Thermotoga

TAS [1, 43, 44]

  

Species T. neapolitana

IGC, TSA [45, 46]

  

strain: RQ7

TAS [1]

 

Gram stain

Negative

TAS [1]

 

Cell shape

Rod

IDA, TAS [1]

 

Motility

Motile

IDA, TAS [1]

 

Sporulation

Not reported

 
 

Temperature range

55–90 °C

TAS [1]

 

Optimum temperature

Around 80 °C

TAS [1]

 

pH range; Optimum

5.5–9; 6.5

IDA, TAS [1]

 

Carbon source

Mono- and polysaccharides

IDA, TAS [1, 47, 48]

MIGS-6

Habitat

Geothermally heated sediments

TAS [1]

MIGS-6.3

Salinity

0.25–3.75% NaCl (w/v)

IDA, TAS [1]

MIGS-22

Oxygen requirement

Anaerobic

IDA, TAS [1]

MIGS-15

Biotic relationship

Free-living

IDA, TAS [1]

MIGS-14

Pathogenicity

Non-pathogen

IDA, TAS [1]

MIGS-4

Geographic location

Azores, Sao Miguel, Ribeira Quente

TAS [1]

MIGS-5

Sample collection

1985

NAS

MIGS-4.1

Latitude

Not reported

 

MIGS-4.2

Longitude

Not reported

 

MIGS-4.4

Altitude

About sea level

NAS

aEvidence codes - IDA Inferred from Direct Assay, TAS Traceable Author Statement (i.e., a direct report exists in the literature), NAS Non-traceable Author Statement (i.e., not directly observed for the living, isolated sample, but based on a generally accepted property for the species, or anecdotal evidence), IGC Inferred from Genomic Content (i.e., average nucleotide identity, syntenic regions). These evidence codes are from the Gene Ontology project [49]

Fig. 1

Phylogenetic tree showing the position of T. sp. strain RQ7 relative to other species within the order Thermotogales. Only species with complete genome sequences are included. The tree was built with 16S rRNA gene sequences, using the Neighbor-Joining method with MEGA7 [50]. Fervidobacterium nodosum serves as the outgroup

Like its close relatives T. neapolitana DSM 4359 and T. maritima MSB8, T. sp. strain RQ7 is a strict anaerobe, growing best around 80 °C, utilizing both simple and complex sugars, and producing hydrogen gas. These bacteria grow in both rich and defined media, are free living and non-pathogenic to humans, animals, or plants. Cells are rod-shaped, about 0.5 to 2 μm in length and 0.4 to 0.5 μm in diameter (Fig. 2). The most distinctive feature of Thermotoga cells is the “toga” structure that balloons out from both ends of the rod [1, 11], an extension of their outer membrane [12].
Fig. 2

Scanning electron micrograph of T. sp. strain RQ7 cells after 12 h of growth. Bar, 0.5 μm

Genome sequencing information

Genome project history

The project started in June 2011, and the genome was sequenced by BGI Americas (Cambridge, MA) using the Illumina technology. A total of 400 Mb of clean data were generated, which covered the genome more than 200 fold. The assembled scaffold covers 97.7% of the chromosome. PCR and Sanger sequencing were later used for gap filling. The assembly was finalized in February 2014, and the complete sequence was submitted to the GenBank in April 2014. The sequence was annotated with the NCBI Prokaryotic Genome Annotation Pipeline [13] and the DOE-JGI Microbial Genome Annotation Pipeline (MGAP v.4) [14]. The project information is summarized in Table 2.
Table 2

Project information

MIGS ID

Property

Term

MIGS 31

Finishing quality

Complete

MIGS-28

Libraries used

Three Illumina paired-end libraries in sizes of 500, 2000, and 5000 bp

MIGS 29

Sequencing platforms

Illumina and Sanger

MIGS 31.2

Fold coverage

> 200×

MIGS 30

Assemblers

SOAPdenovo [17], SOAPaligner [18], CLC Workbench 5.1 [19], and GapFish [20]

MIGS 32

Gene calling method

GeneMarkS+ [51], Prodigal [52]

 

Locus Tag

TRQ7 in GenBank; Ga0077854 in JGI-IMG

 

GenBank ID

CP007633, KF798180

 

GenBank Date of Release

February 4, 2015

 

GOLD ID

Gp0117593

 

BIOPROJECT

PRJNA246218

MIGS 13

Source Material Identifier

Personal culture collection (Dr. Harald Huber)

 

Project relevance

Bioenergy, biotechnology, evolution

Growth conditions and genomic DNA preparation

T. sp. strain RQ7 was kindly provided by Drs. Harald Huber and Robert Huber at the University of Regensburg, Germany. It was cultivated in SVO medium [15] at 77 °C, and its genomic DNA was extracted with standard phenol extraction method [16]. Briefly, cells from 250 ml of overnight culture were collected by centrifugation and resuspended in 10 ml of STE solution (10 mM Tris-HCl, 1 mM EDTA, 100 mM NaCl, pH 8.0). SDS and proteinase K were added to a final concentration of 1% (w/v) and 20 μg/ml. The mixture was incubated at 50 °C for 6 h followed by the addition of an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1, v/v/v). After gentle mixing, the mixture was centrifuged at 12,000 g at 4 °C for 15 min. The upper aqueous layer was transferred to a clean tube and mixed with 1/10 volume of 3 M sodium acetate (pH 5.5) and 2 volumes of ice cold 95% (v/v) ethanol. The DNA was spooled out by a glass rod, washed with 70% (v/v) ethanol, air dried, dissolved in 2 ml of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) containing 20 μg/ml RNase A, and stored at −20 °C.

Genome sequencing and assembly

The genome of T. sp. strain RQ7 was mainly sequenced by BGI Americas using Illumina HiSeq 2000 sequencing platform. Three paired-end libraries, in size of 500, 2000, and 5000 kb, were constructed. The raw data were filtered by a quality control step and generated 400 Mb of clean data, which indicated a coverage of more than 200-fold. The reads were assembled by SOAPdenovo [17] and polished by SOAPaligner [18]. This resulted in a single scaffold of 1,822,593 bp that covered 97.7% of the genome and contained 28 gaps. The gap filling efforts included the integration of the current scaffold with contigs generated by the CLC Genomics Workbench [19] and a small amount of public sequences in GenBank. GapFish [20] was then used to solve a dozen ambiguous regions. Finally, PCR and primer walking were performed to close the remaining gaps, resulting a final assembly of 1,851,618 bp. The entire assembling process integrated wet lab methods with in silico approaches, and the programs used included public software (SOAPdenovo and SOAPaligner [17, 18]), a commercial product (CLC Genomics Workbench [19]), and an in-house program GapFish [20]. Details of the assembling process are described in our previous report [20].

Genome annotation

The genome was independently annotated by two pipelines, the NCBI Prokaryotic Genome Annotation Pipeline [13] and the DOE-JGI Microbial Genome Annotation Pipeline (MGAP v.4) [14]. Both pipelines combine a gene-calling algorithm with a similarity-based gene detection approach, even though the algorithms and databases they use are different. For example, PGAAP uses GeneMarkS+ for de novo gene prediction, while MGAP uses Prodigal. Consequently, the two pipelines produced slightly different annotation results. The analyses in this report took into consideration of the results from both pipelines and are assisted with manual curation.

Genome properties

The genome of T. sp. strain RQ7 is composed of a circular chromosome of 1,851,618 bp with a GC content of 47.05% and a single mini-plasmid of 846 bp with a GC percentage of 39.95 (Fig. 3; Table 3). The plasmid pRQ7 has been characterized [9] and sequenced [6, 21] before. According to the annotation of MGAP, the chromosome carries 1906 putative genes, of which, 1853 are protein coding genes and 53 are RNA genes (Table 4). Among all the genes that are assigned to a COG category (Table 5), a significant portion (~12%, 191 genes) are devoted to carbohydrate utilization, which is typical to Thermotoga strains and accords with their versatile use of carbon and energy sources.
Fig. 3

Chromosomal map of T. sp. strain RQ7. From outside to the center: genes on forward strand (color by COG categories), genes on reverse strand (color by COG categories), RNA genes (tRNAs: green, rRNAs: red, other RNAs: black), GC content (black), GC skew (olive/purple)

Table 3

Summary of genome: one chromosome and one plasmid

Label

Size (bp)

Topology

INSDC identifier

RefSeq ID

Chromosome

1,851,618

Circular

CP007633

NZ_CP007633

pRQ7

846

Circular

KF798180

NC_023152

Table 4

Genome statistics according to the MGAP pipeline annotation (chromosome only)

Attribute

Value

% of total

Genome size (bp)

1,851,618

100.00

DNA coding (bp)

1,768,561

95.51

DNA G + C (bp)

871,250

47.05

DNA scaffolds

1

 

Total genes

1906

100.00

Protein coding genes

1853

97.22

RNA genes

53

2.78

Pseudo genes

Genes in internal clusters

110

5.77

Genes with function prediction

1522

79.85

Genes assigned to COGs

1453

76.23

Genes with Pfam domains

1629

85.47

Genes with signal peptides

35

1.84

Genes with transmembrane helices

462

24.24

CRISPR repeats

8

 
Table 5

Number of genes associated with general COG functional categories

Code

Value

%age

Description

J

165

10.17

Translation, ribosomal structure and biogenesis

A

RNA processing and modification

K

75

4.62

Transcription

L

53

3.27

Replication, recombination and repair

B

1

0.06

Chromatin structure and dynamics

D

19

1.17

Cell cycle control, Cell division, chromosome partitioning

V

34

2.09

Defense mechanisms

T

57

3.51

Signal transduction mechanisms

M

74

4.56

Cell wall/membrane biogenesis

N

55

3.39

Cell motility

U

21

1.29

Intracellular trafficking and secretion

O

66

4.07

Posttranslational modification, protein turnover, chaperones

C

104

6.41

Energy production and conversion

G

191

11.77

Carbohydrate transport and metabolism

E

169

10.41

Amino acid transport and metabolism

F

65

4

Nucleotide transport and metabolism

H

73

4.5

Coenzyme transport and metabolism

I

42

2.59

Lipid transport and metabolism

P

103

6.35

Inorganic ion transport and metabolism

Q

18

1.11

Secondary metabolites biosynthesis, transport and catabolism

R

156

9.61

General function prediction only

S

75

4.62

Function unknown

453

23.77

Not in COGs

The total is based on the total number of protein coding genes in the genome as annotated by MGAP v.4 [14]

Insights from the genome sequence

The chromosomal sequence of T. sp. strain RQ7 was compared to those of T. maritima MSB8, T. neapolitana DSM 4359 , and T. sp. strain RQ2, with emphases on the genetic elements that have the highest impacts on genetic engineering attempts, such as natural competence genes, CRISPRs, and R-M systems.

Full genome comparison

The alignment of the complete genomic sequence of the four Thermotoga strains (Fig. 4) revealed high levels of synteny among their genomes, particularly within the pairs of T. sp. strain RQ7−T. neapolitana DSM 4359 and T. sp. strain RQ2−T. maritima MSB8. This is in agreement with their placements in the phylogenetic tree (Fig. 1). The average nucleotide identity between T. sp. strain RQ7 and the type strain T. neapolitana DSM 4359 is 98.49%, which is higher than the conventional cutoff of 95% for species delineation [22]. Therefore, T. sp. strain RQ7 should be considered as a strain of T. neapolitana , same as T. sp. strain RQ2 to T. maritima [23].
Fig. 4

Full genome alignment of the four Thermotoga strains using Mauve [53]. Each horizontal panel represents one genome sequence, from top to bottom: T. neapolitana DSM 4359, T. sp. strain RQ7, T. sp. strain RQ2, and T. maritima MSB8. The sequences were downloaded from GenBank, and genomes of T. neapolitana DSM 4359 and T. maritima MSB8 were re-linearized at the dnaA gene. Blocks with the same color represent homologous regions. Blocks below the center lines are inversed regions. Inside of each block, the height of the similarity profile corresponds to the average level of conservation of the local area

A detailed comparison of T. sp. strain RQ7 and T. neapolitana DSM 4359 found 100 genes belonging only to the former and 120 genes only to the latter. Some of these genes became unique because their counterparts in the other genome have mutated to a pseudogene. However, many of the unique genes seem to have been acquired via recent lateral gene transfer events. The putative functions of these genes are mainly associated to transportation and utilization of carbohydrates and nucleotides. The most notable gene clusters include TRQ7_01555-01655 (nucleotide metabolism), TRQ7_02675-02725 (carbohydrate metabolism), TRQ7_03440-03490 (arabinose metabolism), CTN_0026-0038 (synthesis of antibiotics), CTN_0236-0245 (carbohydrate metabolism), CTN_0355-0373 (ribose metabolism), CTN_1540-1554 (carbohydrate metabolism), and CTN_1602-1627 (ribose metabolism). Follow-up functional genomics studies are needed to validate the predictions on these gene functions and metabolic pathways.

Natural competence

Thermotoga species are known to undergo lateral gene transfer events. One of the ways this could happen is via natural transformation. Natural competence has been established in T. sp. strain RQ7 [7] and T. sp. strain RQ2 [8]. Using experimentally characterized competence genes as references, we are able to identify the genes that might play a role in natural competence in Thermotoga (Table 6). These genes are widely spread among bacterial genomes, and none of them are clustered into operons. This might imply a primitive form of natural competence that is shared by most, if not all, bacteria. Perhaps, most free-living bacteria are more or less naturally competent during some points of their life. The trick is to identify the right conditions under which the natural competence will be allowed to develop.
Table 6

Manually curated competence genes

RQ7

Gene namea

Putative function

Tn

Tm

RQ2

DNA uptake and translocation

 TRQ7_00110

pilZ (Pa, Vc)

Type IV pilus biogenesis and twitching motility [5456]

CTN_1670

TM0905

TRQ2_0022

 TRQ7_00455

pilB (Pa, Vc)

Type II secretion system (T2SS), Type IV fimbrial assembly NTPase [5759]

CTN_1739

TM0837

TRQ2_0090

 TRQ7_01410

 TRQ7_04530

 TRQ7_08710

pilQ (Nm, Tt)

Secretin, forms gated channel for extrusion of assembled pilin [6062]

CTN_1450

CTN_1933

CTN_0604

TM1117

TM0088

TRQ2_1699

TRQ2_0859

 TRQ7_04500

pilC (Ps, Ng)

Type II secretory pathway, component PulF / Type IV fimbrial assembly protein [63, 64]

CTN_0598

TM_0094

TRQ2_0853

 TRQ7_05855

pilD (Vv,Ng)

Type IV prepilin peptidase, processes N-terminal leader peptides for prepilins [6567]

CTN_0883

TM1696

TRQ2_1138

 TRQ7_06260

comEC (Bs)

Putative channel protein, Transports DNA across the cell membrane [68, 69]

CTN_0965

TM1775

TRQ2_1049

 TRQ7_07315

comF (Hi)

Phosphoribosyltransferase [70, 71]

CTN_1168

TM1584

TRQ2_1247

 TRQ7_07650

pilT (Ng)

Motility protein [72]

CTN_1229

TM1362

TRQ2_1467

 TRQ7_07980

pilE (Ng, Pa)

Type IV pilin; major structural component of Type IV pilus [73, 74]

CTN_1301

TM1271

TRQ2_1548

 TRQ7_09065

comEA (Bs)

High affinity DNA-binding periplasmic protein [7578]

CTN_1515

TM1052

TRQ2_1756

Post-translocation

 TRQ7_02260

comM (Hi)

Promotes the recombination of the donor DNA into the chromosome [79]

CTN_0158

TM0513

TRQ2_0424

 TRQ7_03645

dprA (Hi)

DNA protecting protein [80, 81]

CTN_0436

TM0250

TRQ2_0698

aGene names are given after the experimentally characterized genes of the species in parentheses. Pa Pseudomonas aeruginosa, Vc Vibrio cholerae, Nm Neisseria meningitidis, Tt Thermus thermophilus, Ps Pseudomonas stutzeri, Ng Neisseria gonorrhoeae, Vv Vibrio vulnificus, Bs Bacillus subtilis, Hi influenza, RQ7 T. sp. strain RQ7, Tn T. neapolitana DSM 4359, Tm T. maritima MSB8, RQ2 T. sp. strain RQ2

CRISPRs

CRISPRs provide prokaryotes a form of adaptive immunity against invading phages and plasmids in a sequence specific manner [24, 25]. The system utilizes non-coding CRISPR RNA and a set of CRISPR-associated proteins to target invading nucleic acid, including both DNA and RNA. CRISPRs have been reported to prevent natural transformation [26, 27]. They have been noticed before in Thermotoga and are credited for large scale chromosomal recombination events in these species [28, 29]. NCBI’s PGAAP pipeline identified 6 loci of CRISPR arrays in T. sp. strain RQ7, whereas JGI-IMG’s MGAP pipeline and a manual analysis using CRISPRFinder [30] recognized a total of 8 loci (Table 7). Among these eight CRISPR loci, #1 and #3 are the ones not considered by PGAAP. Two clusters of cas genes are also found. The cas6-cas2 cassette is sandwiched between loci #3 and #4, and the cas6-csm1 cassette is located 2285 bp upstream of locus #3 (Fig. 5, Table 7).
Table 7

Summary of CRISPR loci in T. sp. strain RQ7

Locus

Repeats

Coordinatesa

No. of spacers

Cas genes

1

GTTTCAATCCTTCCTTAGAGGTATGGAAACA

GTTTCAATACTTCCTTAGAGGTATGGAAACA

GTTTCAATACTTCCTTTGAGGTATGAAAACA

553,849-554,014

2

No

2

TTTCCTATACCTCTAAGAAAGGATTGAAAC

GTTTCCATACCTCTAAGGAAGTATTGAAAC

594,500-594,927

6

No

3

GTTTCAATACTTCCTTTGAGGTATGGAAA

GTTTCAATACTTCCTTAGAGGTATGGAAA

GTTTCAATACATCCTCAGAGGTATGATTT

975,191-975,420

3

Yes

4

GTTTTTATCTTCCTAAGAGGAATATGAAC

GTTTTTATCTTCCTAAGAGGAATATAGTA

983,596-986,955

51

Yes

5

GTTTCAATACTTCCTTTGAGGTATGGAAAC

GTTTCAATATTTCCTTATAGGTACAAACCC

1,011,410-1,012,101

10

No

6

GTTTCAATACTTCCTTAGAGGTATGGAAAC

1,090,312-1,090,681

5

No

7

GTTTCCATACCTCTAAGGAAGTATTGAAAC

1,233,649-1,233,878

3

No

8

GTTTCAATACTTCCTTTGAGGTATGGAAAC

1,422,811-1,423,509

10

No

aCoordinates as documented in JGI-IMG. The start coordinates in GenBank are 20 bp smaller because the chromosome is linearized at a site 20 bp downstream of what JGI-IMG uses

Fig. 5

Diagrammatic representation of CRISPR/Cas systems in T. sp. strain RQ7. a Positions of the 8 regions of CRISPR arrays; drawn in scale using Clone Manager Professional Suite v.8 [82]. b Positions of the cas genes (open boxed) relative to the CRISPR arrays (filled boxes); not in scale

Although analysis with CRISPRFinder revealed the same number of CRISPR loci in the four close relatives, i.e. T. sp. strain RQ7, T. neapolitana DSM 4359 , T. maritima MSB8, and T. sp. strain RQ2, the total number of spacers they carry vary dramatically, as 95, 60, 106, and 129 spacers are found respectively. T. maritima MSB8 and T. sp. strain RQ2 also harbor RNA-targetting cmr genes in addition to DNA-targetting cas genes [31]. These differences may affect the efficiency of lateral gene transfer events among the strains.

Type II R-M system TneDI

R-M systems are other defense mechanisms that prokaryotes have developed to protect the integrity of their genetic materials. The Type II R-M system TneDI has been characterized in T. neapolitana DSM 4359 and overexpressed in Escherichia coli [32, 33]. The nuclease R.TneDI cleaves at the center of the recognition site (CG↓CG), and the methylase M.TneDI modifies one of the cytosines. The TneDI system has been found in many members of the Thermotogaceae family, including T. maritima MSB8 and T. sp. strain RQ2 [32]. However, it is absent from T. sp. strain RQ7, although the neighborhood is still highly conserved (Fig. 6). To exclude the possibility of an assembling error, primers spanning the region in question were designed, and the PCR results confirmed the deletion (Fig. 7). The absence of the TneDI system makes the DNA of T. sp. strain RQ7 susceptible to R.TneDI, and in vitro treatment with M.TneDI provides complete protection to its genomic DNA (Fig. 8).
Fig. 6

Deletion of the TneDI system in T. sp. RQ7. The neighborhoods of the deletion site were compared (color by COG categories). The big rectangle box highlights the R-M system that is absent in T. sp. strain RQ7 (show as RQ7 in the diagram). The numerical values are genome coordinates as documented in JGI-IMG. RQ2, T. sp. strain RQ2; Tm, T. maritima MSB8; Tn, T. neapolitana DSM 4359

Fig. 7

Experimental confirmation of the deletion of the TneDI system in T. sp. strain RQ7. T. neapolitana DSM 4359 (Tn) was used as the positive control. The expected sizes are 1831 bp in T. neapolitana DSM 4359 and 503 bp in T. sp. strain RQ7

Fig. 8

Digestion of the genomic DNA of T. neapolitana DSM 4359 (Tn), T. sp. strain RQ2 (RQ2), T. maritima MSB8 (Tm), and T. sp. strain RQ7 (RQ7) with R.TneDI. -, negative control, no R.TneDI; +, digestion with R.TneDI; m_+, DNA was treated with M.TneDI prior to being digested by R.TneDI

M.TneDI has been predicted to be a m4C methylase based on sequence analysis [32]. It has also been noticed that m4C methylation is more common than m5C in thermophiles, probably due to a reduced risk of deamination [34]. The speculation of M.TneDI being a m4C methylase is further supported by the observation that the genomic DNA of TneDI-bearing species is still suspetible to BstUI (Fig. 9), which is an isoschizomer of R.TneDI and known to be blocked by m5C methylation [35].
Fig. 9

Digestion of genomic DNA of T. maritima MSB8 (Tm), T. neapolitana DSM 4359 (Tn), T. sp. strain RQ2 (RQ2), and T. sp. strain RQ7 by BstUI. -, negative control, no BstUI; +, treated with BstUI

Conclusions

The genome of T. sp. strain RQ7 shares large regions of synteny with those of its close relatives, namely, T. neapolitana DSM 4359 , T. maritima MSB8, and T. sp. strain RQ2. They all have a complete set of putative competence genes, although natural transformation has yet to be established in T. neapolitana DSM 4359 and T. maritima MSB8. The same number of CRISPR loci are found in all four genomes, even though the number of spacers vary. The most noticeable difference among the strains is the absence of the TneDI R-M system in T. sp. strain RQ7, which partially explains why this strain is more amenable to genetic modifications than others. In general, this work sheds light on the genetic features of T. sp. strain RQ7, promoting genetic and genomic studies of Thermotoga spp.

Abbreviations

Cas: 

CRISPR associated

CRISPR: 

Clustered regularly interspaced short palindromic repeats

R-M: 

Restriction-modification

Declarations

Acknowledgements

We are grateful to Drs. Harald Huber and Robert Huber at the University of Regensburg, Germany, for kindly providing T. sp. strain RQ7.

Funding

This work was supported by the BGSU Commercialization Catalyst Award and the BGSU Building Strength Award to ZX. BGSU plays no role in designing or conducting the study, collecting or analysing the data, or writing the manuscript.

Authors’ contributions

ZX conceived and coordinated the study, participated in all aspects of data analysis and drafted the manuscript. RP participated in most parts of the work and helped in writing the manuscript. JX produced the SEM photo and the phylogenetic tree. HX contributed to the R-M study. DH initiated the sequencing project and the R-M study. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Biological Sciences, Bowling Green State University
(2)
School of Life Sciences, Minnan Normal University

References

  1. Huber R, Langworthy TA, Konig H, Thomm M, Woese CR, Sleytr UB, Stetter KO. Thermotoga maritima sp. nov. represents a new genus of unique extremely thermophilic eubacteria growing up to 90 degrees C. Arch Microbiol. 1986;144(4):324–33.View ArticleGoogle Scholar
  2. Schroder C, Selig M, Schonheit P. Glucose Fermentation to Acetate, CO2 and H2 in the Anaerobic Hyperthermophilic Eubacterium Thermotoga Maritima: Involvement of the Embden-Meyerhof Pathway. Arch Microbiol. 1994;161(6):460–70.Google Scholar
  3. Takahata Y, Nishijima M, Hoaki T, petrophila MTT. sp. nov. and Thermotoga naphthophila sp. nov., two hyperthermophilic bacteria from the Kubiki oil reservoir in Niigata, Japan. Int J Syst Evol Microbiol. 2001;51:1901–9.View ArticlePubMedGoogle Scholar
  4. Zhaxybayeva O, Swithers KS, Lapierre P, Fournier GP, Bickhart DM, DeBoy RT, Nelson KE, Nesbo CL, Doolittle WF, Gogarten JP, et al. On the chimeric nature, thermophilic origin, and phylogenetic placement of the Thermotogales. Proc Natl Acad Sci U S A. 2009;106(14):5865–70.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Nesbo CL, Dlutek M, Doolittle WF. Recombination in thermotoga: Implications for species concepts and biogeography. Genetics. 2006;172(2):759–69.View ArticlePubMedPubMed CentralGoogle Scholar
  6. Han D, Norris SM, Xu Z. Construction and transformation of a Thermotoga-E. coli shuttle vector. BMC Biotechnol. 2012;12:2.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Han D, Xu H, Puranik R, Xu Z. Natural transformation of Thermotoga sp. strain RQ7. BMC Biotechnol. 2014;14:39.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Xu H, Han D, Xu Z. Expression of Heterologous Cellulases in Thermotoga sp. Strain RQ2. Biomed Res Int. 2015;2015:304523.PubMedPubMed CentralGoogle Scholar
  9. Harriott OT, Huber R, Stetter KO, Betts PW, Noll KM. A Cryptic Miniplasmid from the Hyperthermophilic Bacterium Thermotoga Sp Strain Rq7. J Bacteriol. 1994;176(9):2759–62.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Frock AD, Notey JS, Kelly RM. The genus Thermotoga: recent developments. Environ Technol. 2010;31(10):1169–81.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Windberger E, Huber R, Trincone A, Fricke H, Stetter KO. Thermotoga thermarum sp. nov. and Thermotoga neapolitana occurring in African continental solfataric springs. Arch Microbiol. 1989;151(6):506–12.View ArticleGoogle Scholar
  12. Rachel R, Engel AM, Huber R, Stetter KO, Baumeister W. A Porin-Type Protein Is the Main Constituent of the Cell-Envelope of the Ancestral Eubacterium Thermotoga-Maritima. FEBS Lett. 1990;262(1):64–8.View ArticleGoogle Scholar
  13. Angiuoli SV, Gussman A, Klimke W, Cochrane G, Field D, Garrity G, Kodira CD, Kyrpides N, Madupu R, Markowitz V, et al. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation. OMICS. 2008;12(2):137–41.View ArticlePubMedPubMed CentralGoogle Scholar
  14. Huntemann M, Ivanova NN, Mavromatis K, Tripp HJ, Paez-Espino D, Palaniappan K, Szeto E, Pillay M, Chen IM, Pati A, et al. The standard operating procedure of the DOE-JGI Microbial Genome Annotation Pipeline (MGAP v.4). Stand Genomic Sci. 2015;10:86.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Van Ooteghem SA, Beer SK, Yue PC. Hydrogen production by the thermophilic bacterium Thermotoga neapolitana. Appl Biochem Biotechnol. 2002;98:177–89.View ArticlePubMedGoogle Scholar
  16. Sambrook J, Russell DW. The Condensed Protocols from Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory Press; 2006.Google Scholar
  17. Li R, Zhu H, Ruan J, Qian W, Fang X, Shi Z, Li Y, Li S, Shan G, Kristiansen K, et al. De novo assembly of human genomes with massively parallel short read sequencing. Genome Res. 2010;20(2):265–72.View ArticlePubMedPubMed CentralGoogle Scholar
  18. SOAPaligner [http://soap.genomics.org.cn/soapaligner.html].
  19. CLC Genomics Workbench [https://www.qiagenbioinformatics.com/products/clc-genomics-workbench/].
  20. Puranik R, Quan G, Werner J, Zhou R, Xu Z. A pipeline for completing bacterial genomes using in silico and wet lab approaches. BMC Genomics. 2015;16(Suppl 3):S7.View ArticlePubMedPubMed CentralGoogle Scholar
  21. Yu JS, Noll KM. Plasmid pRQ7 from the hyperthermophilic bacterium Thermotoga species strain RQ7 replicates by the rolling-circle mechanism. J Bacteriol. 1997;179(22):7161–4.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Goris J, Konstantinidis KT, Klappenbach JA, Coenye T, Vandamme P, Tiedje JM. DNA-DNA hybridization values and their relationship to whole-genome sequence similarities. Int J Syst Evol Microbiol. 2007;57(Pt 1):81–91.View ArticlePubMedGoogle Scholar
  23. Swithers KS, DiPippo JL, Bruce DC, Detter C, Tapia R, Han S, Saunders E, Goodwin LA, Han J, Woyke T, et al. Genome sequence of Thermotoga sp. strain RQ2, a hyperthermophilic bacterium isolated from a geothermally heated region of the seafloor near Ribeira Quente, the Azores. J Bacteriol. 2011;193(20):5869–70.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Sorek R, Kunin V, Hugenholtz P. CRISPR--a widespread system that provides acquired resistance against phages in bacteria and archaea. Nat Rev Microbiol. 2008;6(3):181–6.View ArticlePubMedGoogle Scholar
  25. Garneau JE, Dupuis ME, Villion M, Romero DA, Barrangou R, Boyaval P, Fremaux C, Horvath P, Magadan AH, Moineau S. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature. 2010;468(7320):67–71.View ArticlePubMedGoogle Scholar
  26. Jorth P, Whiteley M. An evolutionary link between natural transformation and CRISPRadaptive immunity. MBio. 2012;3(5):e00309-12.Google Scholar
  27. Bikard D, Hatoum-Aslan A, Mucida D, Marraffini LA. CRISPR interference can prevent natural transformation and virulence acquisition during in vivo bacterial infection. Cell Host Microbe. 2012;12(2):177–86.View ArticlePubMedGoogle Scholar
  28. Mongodin EF, Hance IR, DeBoy RT, Gill SR, Daugherty S, Huber R, Fraser CM, Stetter K, Nelson KE. Gene transfer and genome plasticity in Thermotoga maritima, a model hyperthermophilic species. J Bacteriol. 2005;187(14):4935–44.View ArticlePubMedPubMed CentralGoogle Scholar
  29. DeBoy RT, Mongodin EF, Emerson JB, Nelson KE. Chromosome evolution in the Thermotogales: Large-scale inversions and strain diversification of CRISPR sequences. J Bacteriol. 2006;188(7):2364–74.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Grissa I, Vergnaud G, Pourcel C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007;35(Web Server issue):W52–7.View ArticlePubMedPubMed CentralGoogle Scholar
  31. Haft DH, Selengut J, Mongodin EF, Nelson KE. A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR/Cas subtypes exist in prokaryotic genomes. PLoS Comput Biol. 2005;1(6):e60.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Xu Z, Han D, Cao J, Saini U. Cloning and characterization of the TneDI restriction: modification system of Thermotoga neapolitana. Extremophiles. 2011;15(6):665–72.View ArticlePubMedGoogle Scholar
  33. Xu H, Han D, Xu Z. Overexpression of a lethal methylase, M.TneDI, in E. coli BL21(DE3). Biotechnol Lett. 2014;36(9):1853–9.View ArticlePubMedGoogle Scholar
  34. Ehrlich M, Gama-Sosa MA, Carreira LH, Ljungdahl LG, Kuo KC, Gehrke CW. DNA methylation in thermophilic bacteria: N4-methylcytosine, 5-methylcytosine, and N6-methyladenine. Nucleic Acids Res. 1985;13(4):1399–412.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Jin SG, Kadam S, Pfeifer GP. Examination of the specificity of DNA methylation profiling techniques towards 5-methylcytosine and 5-hydroxymethylcytosine. Nucleic Acids Res. 2010;38(11):e125.View ArticlePubMedPubMed CentralGoogle Scholar
  36. Field D, Garrity G, Gray T, Morrison N, Selengut J, Sterk P, Tatusova T, Thomson N, Allen MJ, Angiuoli SV, et al. The minimum information about a genome sequence (MIGS) specification. Nat Biotechnol. 2008;26(5):541–7.View ArticlePubMedPubMed CentralGoogle Scholar
  37. Woese CR, Kandler O, Wheelis ML. Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc Natl Acad Sci U S A. 1990;87(12):4576–9.View ArticlePubMedPubMed CentralGoogle Scholar
  38. Reysenbach A-L, BII P. Thermotogae phy.nov. In: Garrity GM, Boone DR, Castenholz RW, editors. Bergey's manual of systematic bacteriology, vol. 1. 2nd ed. New York: Springer; 2001. p. 369–87.View ArticleGoogle Scholar
  39. List Editor. Validation of the Publication of New Names and New Combinations Previously Effectively Published Outside the IJSB. List No. 85. Int J Syst Bacteriol. 2002;52(3):685–90.Google Scholar
  40. Reysenbach A-L, Class I. Thermotogae class. nov. In: Garrity GM, Boone DR, Castenholz RW, editors. Bergey's manual of systematic bacteriology, vol. 1. 2nd ed. New York: Springer; 2001. p. 369–87.View ArticleGoogle Scholar
  41. Reysenbach A-L, Order I. Thermotogales ord. nov. Huber and Stetter 1992c, 3809. In: Garrity GM, Boone DR, Castenholz RW, editors. Bergey's manual of systematic bacteriology, vol. 1. 2nd ed. New York: Springer; 2001. p. 369–87.View ArticleGoogle Scholar
  42. Reysenbach A-L, Family I. Thermotogaceae fam. nov. In: Garrity GM, Boone DR, Castenholz RW, editors. Bergey's manual of systematic bacteriology, vol. 1. 2nd ed. New York: Springer; 2001. p. 370–87.Google Scholar
  43. Bhandari V, Gupta RS. Molecular signatures for the phylum (class) Thermotogae and a proposal for its division into three orders (Thermotogales, Kosmotogales ord. nov. and Petrotogales ord. nov.) containing four families (Thermotogaceae, Fervidobacteriaceae fam. nov., Kosmotogaceae fam. nov. and Petrotogaceae fam. nov.) and a new genus Pseudothermotoga gen. nov. with five new combinations. Antonie Van Leeuwenhoek. 2014;105(1):143–68.View ArticlePubMedGoogle Scholar
  44. List Editor. Validation of the Publication of New Names and New Combinations Previously Effectively Published Outside the IJSB. List No. 22. Int J Syst Bacteriol. 1986;36(4):573–6.View ArticleGoogle Scholar
  45. Jannasch HW, Huber R, Belkin S, Stetter, KO. Thermotoga neapolitana sp. nov. of the extremely thermophilic, eubacterial genus Thermotoga. Arch Microbiol. 1988;150(1):103-4Google Scholar
  46. List Editor. Validation of the Publication of New Names and New Combinations Previously Effectively Published Outside the IJSB. List No. 28. Int J Syst Bacteriol. 1989;39(1):93–4.View ArticleGoogle Scholar
  47. Chhabra SR, Shockley KR, Conners SB, Scott KL, Wolfinger RD, Kelly RM. Carbohydrate-induced differential gene expression patterns in the hyperthermophilic bacterium Thermotoga maritima. J Biol Chem. 2003;278(9):7540–52.View ArticlePubMedGoogle Scholar
  48. Yu X, Drapcho CM. Hydrogen production by the hyperthermophilic bacterium Thermotoga neapolitana using agricultural-based carbon and nitrogen sources. Biol Eng Trans. 2011;4(2):101–12.View ArticleGoogle Scholar
  49. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000;25(1):25–9.View ArticlePubMedPubMed CentralGoogle Scholar
  50. Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33(7):1870–4.View ArticlePubMedGoogle Scholar
  51. Besemer J, Lomsadze A, Borodovsky M. GeneMarkS: a self-training method for prediction of gene starts in microbial genomes. Implications for finding sequence motifs in regulatory regions. Nucleic Acids Res. 2001;29(12):2607–18.View ArticlePubMedPubMed CentralGoogle Scholar
  52. Hyatt D, Chen GL, Locascio PF, Land ML, Larimer FW, Hauser LJ. Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics. 2010;11:119.View ArticlePubMedPubMed CentralGoogle Scholar
  53. Darling AC, Mau B, Blattner FR, Perna NT. Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 2004;14(7):1394–403.View ArticlePubMedPubMed CentralGoogle Scholar
  54. Alm RA, Bodero AJ, Free PD, Mattick JS. Identification of a novel gene, pilZ, essential for type 4 fimbrial biogenesis in Pseudomonas aeruginosa. J Bacteriol. 1996;178(1):46–53.View ArticlePubMedPubMed CentralGoogle Scholar
  55. van Schaik EJ, Giltner CL, Audette GF, Keizer DW, Bautista DL, Slupsky CM, Sykes BD, Irvin RT. DNA binding: a novel function of Pseudomonas aeruginosa type IV pili. J Bacteriol. 2005;187(4):1455–64.View ArticlePubMedPubMed CentralGoogle Scholar
  56. Pratt JT, Tamayo R, Tischler AD, Camilli A. PilZ domain proteins bind cyclic diguanylate and regulate diverse processes in Vibrio cholerae. J Biol Chem. 2007;282(17):12860–70.View ArticlePubMedPubMed CentralGoogle Scholar
  57. Chiang P, Sampaleanu LM, Ayers M, Pahuta M, Howell PL, Burrows LL. Functional role of conserved residues in the characteristic secretion NTPase motifs of the Pseudomonas aeruginosa type IV pilus motor proteins PilB, PilT and PilU. Microbiology. 2008;154(Pt 1):114–26.View ArticlePubMedGoogle Scholar
  58. Nunn D, Bergman S, Lory S. Products of three accessory genes, pilB, pilC, and pilD, are required for biogenesis of Pseudomonas aeruginosa pili. J Bacteriol. 1990;172(6):2911–9.View ArticlePubMedPubMed CentralGoogle Scholar
  59. Seitz P, Blokesch M. DNA-uptake machinery of naturally competent Vibrio cholerae. Proc Natl Acad Sci U S A. 2013;110(44):17987–92.View ArticlePubMedPubMed CentralGoogle Scholar
  60. Assalkhou R, Balasingham S, Collins RF, Frye SA, Davidsen T, Benam AV, Bjoras M, Derrick JP, Tonjum T. The outer membrane secretin PilQ from Neisseria meningitidis binds DNA. Microbiology. 2007;153(Pt 5):1593–603.View ArticlePubMedPubMed CentralGoogle Scholar
  61. Burkhardt J, Vonck J, Averhoff B. Structure and function of PilQ, a secretin of the DNA transporter from the thermophilic bacterium Thermus thermophilus HB27. J Biol Chem. 2011;286(12):9977–84.View ArticlePubMedPubMed CentralGoogle Scholar
  62. Collins RF, Davidsen L, Derrick JP, Ford RC, Tonjum T. Analysis of the PilQ secretin from Neisseria meningitidis by transmission electron microscopy reveals a dodecameric quaternary structure. J Bacteriol. 2001;183(13):3825–32.View ArticlePubMedPubMed CentralGoogle Scholar
  63. Graupner S, Frey V, Hashemi R, Lorenz MG, Brandes G, Wackernagel W. Type IV pilus genes pilA and pilC of Pseudomonas stutzeri are required for natural genetic transformation, and pilA can be replaced by corresponding genes from nontransformable species. J Bacteriol. 2000;182(8):2184–90.View ArticlePubMedPubMed CentralGoogle Scholar
  64. Rudel T, Facius D, Barten R, Scheuerpflug I, Nonnenmacher E, Meyer TF. Role of pili and the phase-variable PilC protein in natural competence for transformation of Neisseria gonorrhoeae. Proc Natl Acad Sci U S A. 1995;92(17):7986–90.View ArticlePubMedPubMed CentralGoogle Scholar
  65. Nunn DN, Lory S. Product of the Pseudomonas aeruginosa gene pilD is a prepilin leader peptidase. Proc Natl Acad Sci U S A. 1991;88(8):3281–5.View ArticlePubMedPubMed CentralGoogle Scholar
  66. Freitag NE, Seifert HS, Koomey M. Characterization of the pilF-pilD pilus-assembly locus of Neisseria gonorrhoeae. Mol Microbiol. 1995;16(3):575–86.View ArticlePubMedGoogle Scholar
  67. Paranjpye RN, Lara JC, Pepe JC, Pepe CM, Strom MS. The type IV leader peptidase/N-methyltransferase of Vibrio vulnificus controls factors required for adherence to HEp-2 cells and virulence in iron-overloaded mice. Infect Immun. 1998;66(12):5659–68.PubMedPubMed CentralGoogle Scholar
  68. Hahn J, Inamine G, Kozlov Y, Dubnau D. Characterization of comE, a late competence operon of Bacillus subtilis required for the binding and uptake of transforming DNA. Mol Microbiol. 1993;10(1):99–111.View ArticlePubMedGoogle Scholar
  69. Draskovic I, Dubnau D. Biogenesis of a putative channel protein, ComEC, required for DNA uptake: membrane topology, oligomerization and formation of disulphide bonds. Mol Microbiol. 2005;55(3):881–96.View ArticlePubMedGoogle Scholar
  70. Bakaletz LO, Baker BD, Jurcisek JA, Harrison A, Novotny LA, Bookwalter JE, Mungur R, Munson RS Jr. Demonstration of Type IV pilus expression and a twitching phenotype by Haemophilus influenzae. Infect Immun. 2005;73(3):1635–43.View ArticlePubMedPubMed CentralGoogle Scholar
  71. Larson TG, Goodgal SH. Sequence and transcriptional regulation of com101A, a locus required for genetic transformation in Haemophilus influenzae. J Bacteriol. 1991;173(15):4683–91.View ArticlePubMedPubMed CentralGoogle Scholar
  72. Wolfgang M, Lauer P, Park HS, Brossay L, Hebert J, Koomey M. PilT mutations lead to simultaneous defects in competence for natural transformation and twitching motility in piliated Neisseria gonorrhoeae. Mol Microbiol. 1998;29(1):321–30.View ArticlePubMedGoogle Scholar
  73. Kline KA, Criss AK, Wallace A, Seifert HS. Transposon mutagenesis identifies sites upstream of the Neisseria gonorrhoeae pilE gene that modulate pilin antigenic variation. J Bacteriol. 2007;189(9):3462–70.View ArticlePubMedPubMed CentralGoogle Scholar
  74. Russell MA, Darzins A. The pilE gene product of Pseudomonas aeruginosa, required for pilus biogenesis, shares amino acid sequence identity with the N-termini of type 4 prepilin proteins. Mol Microbiol. 1994;13(6):973–85.View ArticlePubMedGoogle Scholar
  75. Provvedi R, Dubnau D. ComEA is a DNA receptor for transformation of competent Bacillus subtilis. Mol Microbiol. 1999;31(1):271–80.View ArticlePubMedGoogle Scholar
  76. Inamine GS, Dubnau D. ComEA, a Bacillus subtilis integral membrane protein required for genetic transformation, is needed for both DNA binding and transport. J Bacteriol. 1995;177(11):3045–51.View ArticlePubMedPubMed CentralGoogle Scholar
  77. Chen I, Gotschlich EC. ComE, a competence protein from Neisseria gonorrhoeae with DNA-binding activity. J Bacteriol. 2001;183(10):3160–8.View ArticlePubMedPubMed CentralGoogle Scholar
  78. Takeno M, Taguchi H, Akamatsu T. Role of ComEA in DNA uptake during transformation of competent Bacillus subtilis. J Biosci Bioeng. 2012;113(6):689–93.View ArticlePubMedGoogle Scholar
  79. Gwinn ML, Ramanathan R, Smith HO, Tomb JF. A new transformation-deficient mutant of Haemophilus influenzae Rd with normal DNA uptake. J Bacteriol. 1998;180(3):746–8.PubMedPubMed CentralGoogle Scholar
  80. Mortier-Barriere I, Velten M, Dupaigne P, Mirouze N, Pietrement O, McGovern S, Fichant G, Martin B, Noirot P, Le Cam E, et al. A key presynaptic role in transformation for a widespread bacterial protein: DprA conveys incoming ssDNA to RecA. Cell. 2007;130(5):824–36.View ArticlePubMedGoogle Scholar
  81. Karudapuram S, Zhao X, Barcak GJ. DNA sequence and characterization of Haemophilus influenzae dprA+, a gene required for chromosomal but not plasmid DNA transformation. J Bacteriol. 1995;177(11):3235–40.View ArticlePubMedPubMed CentralGoogle Scholar
  82. Clone Manager [http://www.scied.com/index.htm].

Copyright

© The Author(s). 2017

Advertisement